View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_272 (Length: 231)
Name: NF11280A_low_272
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_272 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 225
Target Start/End: Complemental strand, 37492344 - 37492128
Alignment:
| Q |
9 |
gaaatgaaatggaatggattggatcagaatggatcggattggacggaacacagcttctgtaatctgaactgctttgctccttatcctttgccatttcaag |
108 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492344 |
gaaatgaaatggaatggattggatcggaatggatcggattggacggaacacagcttctgtaatctgaactgctttgctccttatcctttgccatttcaag |
37492245 |
T |
|
| Q |
109 |
taaaacaaccaaagaaatcaaagcatcattacaaaaataagagtagcatcattctaatttgaaattaaatgtaaacagaatgatcttaaccactatgcag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37492244 |
taaaacaaccaaagaaatcaaagcatcattacaaaaataagagtagcatcattctgatttgaaattaaatgtaaacagaatgattttaaccactatgcag |
37492145 |
T |
|
| Q |
209 |
tatgcacatacaccatg |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37492144 |
tatgcacatacaccatg |
37492128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University