View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_276 (Length: 230)
Name: NF11280A_low_276
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_276 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 48674225 - 48674002
Alignment:
| Q |
7 |
gatccatacaagcctttccattgcaaccgaggaatcttactggttgccagacacaatctattgaattattgaaattggtctagattatataattctcaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674225 |
gatccatacaagcctttccattgcaaccgaggaatcttactggttgccagacacaatctattgaattattgaaattggtctagattatataattctcaac |
48674126 |
T |
|
| Q |
107 |
atcaattatcaggtagtggtggaccttgttaaccattcaagagtatcataattttctttaatgaaaaatgaaattaatattcaaattcgtcttttaaatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48674125 |
atcaattatcaggtagtggtggaccttgttaaccattcaagagtatcataattttctttaatgaaaaatgaaattaatattcaaattggtcttttaaatt |
48674026 |
T |
|
| Q |
207 |
ataggaatgtattaatcttttttg |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48674025 |
ataggaatgtattaatcttttttg |
48674002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University