View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_277 (Length: 230)
Name: NF11280A_low_277
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_277 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 28 - 213
Target Start/End: Complemental strand, 35603848 - 35603664
Alignment:
| Q |
28 |
tatctctactgtagaatatcatgtcatttttaatggatgttcacaatgggccaattactcctgaaagagttctccgacaaagatgtcccctctcgccata |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603848 |
tatctctactgtagaatatcatgtcatttttaatg-atgttcacaatggaccaattactcctgaaagagttctccgacaaagatgtcccctctcgccata |
35603750 |
T |
|
| Q |
128 |
ctcatatattatatgtaccgaaggtttgccggccatcatagaaaataacgagatttagggtaagctttatgagactagtatctatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35603749 |
ctcatatattatatgtaccgaaggtttgccggccatcataaaaaataacgagatttagggtaagctttatgagactcgtatctatg |
35603664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University