View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_28 (Length: 413)
Name: NF11280A_low_28
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 128 - 196
Target Start/End: Original strand, 32265888 - 32265956
Alignment:
| Q |
128 |
atgtgatcttttatgtcctcctaatgcttgtcctgacctgaaaattttataacaaattggacattcata |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
32265888 |
atgtgatcttttatgtcctcctaatgcttgtcctgacctgaaaattttgtagcaaattggacattcata |
32265956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University