View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_280 (Length: 230)
Name: NF11280A_low_280
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_280 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 2558338 - 2558189
Alignment:
| Q |
1 |
ggatatgtaaataacaatcaagttttataaccaagatttcattatggttgtttggttggaacctagattgtttgaagtgatcctctgatcccctattaca |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2558338 |
ggatatgtaaataacagtcaagttttataaccaagatttcattatggttgtttggttggaacctagattgtttgaagtgatcctctgatcccctattaca |
2558239 |
T |
|
| Q |
101 |
ccaattatgctattgaatgtagatactagaagtgctttattgtaggctgt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2558238 |
ccaattatgctattgaatgtagatactagaagtgctttattgtaggctgt |
2558189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 13 - 141
Target Start/End: Complemental strand, 2578645 - 2578519
Alignment:
| Q |
13 |
aacaatcaagttttataaccaagatttcattatggttgtttggttggaacctagattgtttgaagtgatcctctgatcccctattacaccaattatgcta |
112 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
2578645 |
aacaatcaagttctataacaaagatttcattatggttctttgattggaacctagattgttcgaagtgatcctctgat--cctattacaccatttatgcta |
2578548 |
T |
|
| Q |
113 |
ttgaatgtagatactagaagtgctttatt |
141 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
2578547 |
ttgaatctagatactagaagtgctttatt |
2578519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 224
Target Start/End: Complemental strand, 2557973 - 2557904
Alignment:
| Q |
154 |
aaaccaactatcctaagtgcgcatctaggaacccgagtctgggagtgcataatataaaaattgggttaaag |
224 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2557973 |
aaaccaactattctaagtgcgcatctaggaaccgg-gtcagggagtgcataatataaaaattgggttaaag |
2557904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University