View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_287 (Length: 230)
Name: NF11280A_low_287
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_287 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 35 - 210
Target Start/End: Original strand, 26597684 - 26597859
Alignment:
| Q |
35 |
aatatgatctaagacagctagtaaatggaacaaggtcaacccatttcccatctataccgacagcggctacggatgagtttttctccggtcaccggaatct |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597684 |
aatatgatctaagacagctagtaaatggaacaaggtcaacccatttcccatctataccgacagcggctacggatgagtttttctccggtcaccggaatct |
26597783 |
T |
|
| Q |
135 |
gacagctttgttaactactactcatccacagacacatcaaaaccagtatgagatgatgatgttagggcgtggagta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597784 |
gacagctttgttaactactactcatccacagacacatcaaaaccagtatgagatgatgatgttagggcgtggagta |
26597859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University