View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_290 (Length: 230)
Name: NF11280A_low_290
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_290 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 1916453 - 1916252
Alignment:
| Q |
1 |
ttcattgccaacaagagaagtaaaaggtagcaaatctttgtaacagcatcttctgtccatccctcacagctagacttggtttttcagacactctttagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1916453 |
ttcattgccaacaagagaagtaaaaggtagcaaatctttgtaacagcatcttctgtccatccctcacagctagacttggtttttcagacactctttagta |
1916354 |
T |
|
| Q |
101 |
gacttcaaatttcatgtactatatattaatcatatcaaatgtattagaaaagttaacaacaaccaatcgttgtacactctcctgggtgtaataagtttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
1916353 |
cacttcaaatttcatgtactatatattaatcatatcatatgtactagaaaagttaacaacaaccaatcattg--cacactcctgggtgtaataagtttta |
1916256 |
T |
|
| Q |
201 |
tcac |
204 |
Q |
| |
|
|||| |
|
|
| T |
1916255 |
tcac |
1916252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University