View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_302 (Length: 229)
Name: NF11280A_low_302
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_302 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 29 - 223
Target Start/End: Complemental strand, 39074089 - 39073900
Alignment:
| Q |
29 |
tacagaagacataggtcatgagtttgaattctgannnnnnnnnnnnctctttgggaagacaatcatcaaccctatgcaaacttcacttggtgaaaccttg |
128 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39074089 |
tacagaagacataggtcatgagttcgaattctgaattttttttct-ctctttgggaagacaatcatcaaccctatgcaaacttcacttggtgaaaccttg |
39073991 |
T |
|
| Q |
129 |
tgcaatatggactgtacttcctttttatacatagataaaaatatttaagtataatataatttaacctaactaattaatcactcactaattacctc |
223 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39073990 |
tgcaatatggactgt----cctttttatacatagataaaaatatttaagtataatataatttaacctaactaattaatcactcactaattacctc |
39073900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University