View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_315 (Length: 228)
Name: NF11280A_low_315
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_315 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 54803690 - 54803469
Alignment:
| Q |
1 |
tactattgaagtgtgcttttggattaatttataaaatttaaaaagggtgtggaaaaaatgccacgaaggtgaaaatgatatttgtattattcatatctta |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803690 |
tactattgaagtgtgcgtttggattaatttataaaatttaaaaagggtgtggaaaaaattccacgaaggtgaaaatgatatttgtattattcatatctta |
54803591 |
T |
|
| Q |
101 |
ttctatacccaacacatctatcataatatttttgtaggggtatctatcataatattctaatctaaaaaatattgagtgatattttttattcaactttaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803590 |
ttctatacccaacacatctatcataatatttttttaggggcatctatcataatattctaatttaaaaaatattgagtgatattttttattcaactttaga |
54803491 |
T |
|
| Q |
201 |
gctataacaatattatggtgtc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
54803490 |
gctataacaatattatggtgtc |
54803469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University