View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_317 (Length: 227)
Name: NF11280A_low_317
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_317 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 32899226 - 32899387
Alignment:
| Q |
1 |
ggttttggtgtttacaagggtagttttggaattgtgttttgttatgtgttagggagccataggatgtacctatggtggatatttataatttattattata |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32899226 |
ggttttggtgtttccaagggtagttttggaattgtgttttgttatgtgttagggagccataggatgtacctatggtggatatttataatttattattata |
32899325 |
T |
|
| Q |
101 |
agcatgtgttatttagaagtgtttgaattctgtatttttaaattgactaaagtacgtctatg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32899326 |
agcatgtgttatttagaagtgtttgaattctgtatttttaaattgactaaagtacgtctatg |
32899387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University