View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_320 (Length: 227)
Name: NF11280A_low_320
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_320 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 6 - 196
Target Start/End: Original strand, 35574630 - 35574834
Alignment:
| Q |
6 |
aggttagagttaaggttgactgtgatctaacagtggatcagttaacggcgcaggcgaagattgttgacagggattgtagttatggattcgatcttggtta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35574630 |
aggttagagttaaggttgactgtgatctaacagtggatcagttaacggcgcaggcgaagattgttgacagggattgtagttatggattcgatcttggtta |
35574729 |
T |
 |
| Q |
106 |
tgaaaatcatt--------------atatgggattaaattaaattgtttagaaattataccggcannnnnnnnnagacaatagattttgcttgtttgtac |
191 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
35574730 |
tgaaaatcattatttggatttagggatatgggattaaattaaattgtttagaaattataccggcttttttttttagacaatagattatgcttgtttgtac |
35574829 |
T |
 |
| Q |
192 |
tttgt |
196 |
Q |
| |
|
||||| |
|
|
| T |
35574830 |
tttgt |
35574834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University