View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_326 (Length: 226)
Name: NF11280A_low_326
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_326 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 6 - 226
Target Start/End: Complemental strand, 30841800 - 30841580
Alignment:
| Q |
6 |
aataacccctagtacgaggaaataaagaaatggaccaaccacannnnnnnataattaatgttgtttagcaaatatgaggtagaagttttacattgtttta |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30841800 |
aataaccgctagtacgaggaaataaagaaatggaccaaccacatttttttataattaatgttgtttagcaaatatgaggtagaagttttacattgtttaa |
30841701 |
T |
|
| Q |
106 |
aaagtgaaggttacgattttgagtaaagatggggtgtacaattcacttgtatgatcgctcttagtctaatgaggatgatccatcgggctcctctcgtaac |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
30841700 |
aaagtggaggttacgattttgagtaaagatggggtgtacaattcacttgtatgatcgctctgagtccaatgtggatgatccatcgggctcctctcgtaac |
30841601 |
T |
|
| Q |
206 |
ccaacaatggtctctgtgacg |
226 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
30841600 |
gcaacagtggtctctgtgacg |
30841580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University