View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_342 (Length: 220)
Name: NF11280A_low_342
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_342 |
 | |
|
| [»] scaffold0009 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 176; Significance: 6e-95; HSPs: 3)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 40189 - 40010
Alignment:
| Q |
20 |
aaacacagatcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40189 |
aaacacagatcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcac |
40090 |
T |
|
| Q |
120 |
acacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgttgttttgctgcttca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40089 |
acacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgtcgttttgctgcttca |
40010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 21 - 197
Target Start/End: Complemental strand, 33561 - 33391
Alignment:
| Q |
21 |
aacacagatcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcaca |
120 |
Q |
| |
|
|||||||||| || ||||||||| ||||||||||||| ||| | ||||| |||||| ||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
33561 |
aacacagatcgagcgttttaagcaaaggaagatcaactgaacaacgagat------ggtacaattattctatccaatttgagaaccacaagtgtttcaca |
33468 |
T |
|
| Q |
121 |
cacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgttgttttgctgctt |
197 |
Q |
| |
|
||||||||||||||| ||||| |||||| || ||||||||||||||||||||| || || ||| |||||||||||| |
|
|
| T |
33467 |
cacgaaaatggtaggcgacaaggtcacttctaccatgcatagatagagatcctcgaccccacgtcgttttgctgctt |
33391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 198
Target Start/End: Complemental strand, 21826 - 21734
Alignment:
| Q |
106 |
cacaagtgtttcacacacgaaaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgttgttttgctgcttc |
198 |
Q |
| |
|
|||||||||| ||| |||||||||||||| ||||| |||||| ||||| | ||||||||||||||| || || ||| |||||||| |||| |
|
|
| T |
21826 |
cacaagtgttctacaaacgaaaatggtaggcgacaaggtcacttctaacaagtttagatagagatcctcgaccccacgtcgttttgcttcttc |
21734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 135
Target Start/End: Original strand, 19970198 - 19970313
Alignment:
| Q |
20 |
aaacacagatcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcac |
119 |
Q |
| |
|
||||||| || ||||||||| ||||||||||||||||| ||| | ||| |||||| | ||||| || ||| |||||| || |||||||||||||||| |
|
|
| T |
19970198 |
aaacacatataaagggttttgagcgaaggaagatcaacagaagaacgaaacatagttgttacatgtatgctaaacaatttcagaaccacaagtgtttcac |
19970297 |
T |
|
| Q |
120 |
acacgaaaatggtagg |
135 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
19970298 |
agcagaaaatggtagg |
19970313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University