View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_346 (Length: 219)
Name: NF11280A_low_346
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_346 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 198
Target Start/End: Original strand, 46387978 - 46388161
Alignment:
| Q |
15 |
tgagatgaacaaaacaaaaagtaacattttttcaacatccatagcagaaaaattggatgatacatgctagtttattgtaggcaacaaannnnnnnnacaa |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
46387978 |
tgagaagaacaaaacaaaaagtaacattttttcaacattcatagcagaaaaattggatgatacatgttagtttattgtaggcaacaaattttttttacaa |
46388077 |
T |
 |
| Q |
115 |
ctaaaatttattggaagaacattaatgcaaagaagatgattgaaatggtttagagtgtagggaacgagactctgcaactgattt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46388078 |
ctaaaatttattggaagaacattaatgcgaagaagatgattgaaatggtttagagtgtggggaacgagactctgcaactgattt |
46388161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University