View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_349 (Length: 217)
Name: NF11280A_low_349
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_349 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 38807017 - 38807202
Alignment:
| Q |
18 |
acttttagcatatcttgttcttggaaagaattcaaacaaacaacacaacccttcacactttgatgattatcatcatcaccttctccttttgtgaattgaa |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38807017 |
acttttagcatatcatgttcttggaaagaattcaaacaaacaacacaaccctttacactttgatgattatcatcatcaccttctccttttgtgaattgaa |
38807116 |
T |
|
| Q |
118 |
atgttggtattccttggatgacggattcatcgacgccgcgggtccaaatccttggagagaatgctatgaagggttcttcatattgt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38807117 |
atgttggtattccttggatgacggattcatcgacgccgcgagtccaaatccttggagagaatgctatgaagggttcttcattttgt |
38807202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University