View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_350 (Length: 215)
Name: NF11280A_low_350
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_350 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 24 - 181
Target Start/End: Original strand, 29447716 - 29447873
Alignment:
| Q |
24 |
actccaggcaaacaccaatggctgcaatcttcgtatagcgaagaagagttctgcttcattgatgtcttgtaatcttttcggtatactgaaggatgtccgt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29447716 |
actccaggcaaacaccaatggctgcaatcttcgtatagcgaagaagagttctgcttcattgatgtcttgtaatcttttcggtatactgaaggatgtccgt |
29447815 |
T |
 |
| Q |
124 |
cttttctgtaatctgtaagtctacttatgttcatatatatgacttcggttttcatatt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29447816 |
cttttctgtaatctgtaagtctacttatgttcatatatatgacttcggttttcatatt |
29447873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 160
Target Start/End: Original strand, 14584246 - 14584320
Alignment:
| Q |
86 |
tgtcttgtaatcttttcggtatactgaaggatgtccgtcttttctgtaatctgtaagtctacttatgttcatata |
160 |
Q |
| |
|
||||||||| || ||| ||||| ||| ||||| ||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
14584246 |
tgtcttgtattccattctgtatattgatggatgggcgtcttttctgtaatctgtcatcctacttatgttcatata |
14584320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University