View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_356 (Length: 213)
Name: NF11280A_low_356
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_356 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 98 - 188
Target Start/End: Complemental strand, 30198406 - 30198316
Alignment:
| Q |
98 |
catggtcgatgtaaagttatttcacattgacatttaatggaaactcgtgaaaatgctattgaagtccacattataaaatttaaacacatca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30198406 |
catggtcgatgtaaagttatttcacattgacatttaatggaaactcgtgaaaatgctattgaagtccacattataaaatttaaacatatca |
30198316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University