View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_360 (Length: 211)
Name: NF11280A_low_360
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_360 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 40211522 - 40211347
Alignment:
| Q |
14 |
atggacatcatatatgccactgaagcaatgtttattttcattttttactatagaaaatctttatattatatagatagaaaataataaagggtgggggtgg |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40211522 |
atggacaacatatatgccactgaagcaatgtttattttcattttttactatagaaaatctttatattatatagatagaaaataataaagggtgggggtgg |
40211423 |
T |
|
| Q |
114 |
caaatgatagggaccaaaattactataggcattcagaattgacatgtatgtatgctgctattgccgcccacttagc |
189 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40211422 |
caaatgatagtgaccaaaattactataggcattcggaattgacatgtatgtatgctgctattgccgcccacttagc |
40211347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University