View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_366 (Length: 208)
Name: NF11280A_low_366
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_366 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 22 - 208
Target Start/End: Complemental strand, 38145410 - 38145224
Alignment:
| Q |
22 |
cacttcttactcttagatggattccaagtttcttggagcaaattacggctgcttggacatgggaatcttgggagggtgtgaatatgaattcgggtttcgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38145410 |
cacttcttactcttagatggattccaagtttcttggagcaaattacggctgcttggacatgggaatcttgggagggtgtgaatatgaattcgggtttcgg |
38145311 |
T |
|
| Q |
122 |
tgtagatggtgccaaacaccttaggttcattgctaagaaatcaaggatggttgcgaatgaaggttcatttggagtgtaaattgttgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38145310 |
tgtagatggtgccaaacaccttaggttcattgctaaggaatcaaggatggttgcgaatgaaggttcatttggagtgtaaattgttgt |
38145224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 22 - 145
Target Start/End: Original strand, 11787410 - 11787533
Alignment:
| Q |
22 |
cacttcttactcttagatggattccaagtttcttggagcaaattacggctgcttggacatgggaatcttgggagggtgtgaatatgaattcgggtttcgg |
121 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| || ||| | || ||| |||||||||| ||||| ||||||||||||||||||||||||| || |
|
|
| T |
11787410 |
cacttcttactcttagatgaataccaagtttctttgaacaagtaacagctacttggacatgtgaatcggttaagggtgtgaatatgaattcgggttttgg |
11787509 |
T |
|
| Q |
122 |
tgtagatggtgccaaacaccttag |
145 |
Q |
| |
|
| ||| ||| ||||| ||||||| |
|
|
| T |
11787510 |
agcagaaggtaccaaataccttag |
11787533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University