View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_367 (Length: 208)
Name: NF11280A_low_367
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_367 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 36698990 - 36698818
Alignment:
| Q |
20 |
aaacactcatctcttctttgatgatcacccgtctcaaattgccaacaaaatatatgcaacacgttgctttattgagaagacaatatgcaagccatctggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36698990 |
aaacactcatctcttctttgatgatcacgcgtctcaaattgccaacaaaatatatgcaacacattgctttattgagaagacaatatgcaagccatctggc |
36698891 |
T |
|
| Q |
120 |
ttcaagatgctctaattaataatcagttgtattatttgaacaacaaaattcaaatatacgccctaagtataat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36698890 |
ttcaagatgctctaattaataatcagttgtattatttgaacaacaaaattcaaatatacgccctaagtataat |
36698818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 20 - 177
Target Start/End: Complemental strand, 143935 - 143777
Alignment:
| Q |
20 |
aaacactcatctcttctttgatgatcacccgtctcaaattgccaacaaaatatatgcaacacgttgctttattgagaagacaatatgcaagccatctggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
143935 |
aaacactcatctcttctttgatgatcacccctctcaaattgccaacaaaatatatgcaacacgttgcttcattgagaagacaatatgcaagccatctagc |
143836 |
T |
|
| Q |
120 |
ttcaagatgctctaattaat-aatcagttgtattatttgaacaacaaaattcaaatata |
177 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
143835 |
ttcaaaatgctctaattaataaatcagttgtattatttgaacaacaaaatacaaatata |
143777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University