View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_381 (Length: 203)
Name: NF11280A_low_381
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_381 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 29 - 189
Target Start/End: Original strand, 45342980 - 45343140
Alignment:
| Q |
29 |
aagggccttccacttgttaaagcttcaaataaaagttgtactgaatgttttgtcggcaagcaacatagagatgccattccaaagaagagtcaatggagag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342980 |
aagggccttccacttgttaaagcttcaaataaaagttgtactgaatgttttgtcagcaagcaacatagagatgccattccaaagaagagtcaatggagag |
45343079 |
T |
|
| Q |
129 |
cttcccaaaaattgcagcttgtacatgctgatgtttgcgggcctattactcccaacaccaa |
189 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
45343080 |
cttcccataaattgcagcttgtacatgctgatatttgcgggcctattactcccaactccaa |
45343140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University