View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_58 (Length: 355)
Name: NF11280A_low_58
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 5 - 347
Target Start/End: Complemental strand, 28668252 - 28667909
Alignment:
| Q |
5 |
caatttcatcataaa-cattttcgagtgcgaaatgaaaagagttgttaccgccatcaagaggtgtttctgctgggtgctctacggtctggaaaaaatcag |
103 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
28668252 |
caatttcatcagaaaacattttcgagtgcgaaatgaaaagagttgttaccgccatcaagaggtgtttctgttgggtgctctacggtctagaaaaaatcag |
28668153 |
T |
|
| Q |
104 |
tttcaacgagagcaataatataaggtgaagcttgctgttcaggatgctctattctcgtatcagacaccgcaatttcaaaagcaacaactggttttggaaa |
203 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
28668152 |
tttcaacgggagcaataatagaaggtgaagcttgttgttcaggatgctctattgtcgtatcagacactgcaatttcaaaagcaacaactggttttgaaaa |
28668053 |
T |
|
| Q |
204 |
atccaaagatgacccaactccgagaggattttcacgttcccaccaaattttggtttgagccttctgctgtatgatggcatatttgcctttgccctgcacc |
303 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
28668052 |
agccaaagatgacccaactccgagaggattttcacgttcccaccaaattttggtttgcgccttctgttgtatgatggcatgtttccctttgccctgcacc |
28667953 |
T |
|
| Q |
304 |
tttttaatgttattattatctctgtccgtattcaaatattcttc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28667952 |
tttttaatgttattattatctctgtccgtattcaaattttcttc |
28667909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University