View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11280A_low_70 (Length: 339)
Name: NF11280A_low_70
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11280A_low_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 130 - 314
Target Start/End: Original strand, 1557181 - 1557364
Alignment:
| Q |
130 |
cttaaccatagttaagtaatgaagtgaactagtattaaataagcataattgtttagaagaaagtaatcctagttaagttgattggtttctccaaaatcaa |
229 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1557181 |
cttaaccatagttaagtaatcaagtgaactagtattaaataagcataattgtttagaagaaagtaatcctagttaagttgattggtttcttcaaaatcaa |
1557280 |
T |
|
| Q |
230 |
gttaacatgggttcaaaattccataagatagtaatcatgaggatcgatctatgaattaatagattaacatagcaaaggcaattgc |
314 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1557281 |
gttaacat-ggttcaaaattccataagatagtaatcatgaggatcgatctatgaattaatacattaacatagcaaaggcaattgc |
1557364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 13 - 99
Target Start/End: Original strand, 1557028 - 1557114
Alignment:
| Q |
13 |
gaagaaatttgttactatagttcatctactagaagaaagataaaatctttgctgacaattgatttcacctaaagagcttagtctcta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| | |||||||||| |
|
|
| T |
1557028 |
gaagaaatttgttactatagttcatctactagaagaaagataaaatctttgttgacaattgatttcacctcaagtgattagtctcta |
1557114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University