View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11281_high_2 (Length: 244)
Name: NF11281_high_2
Description: NF11281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11281_high_2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 5402814 - 5402571
Alignment:
| Q |
1 |
tccaattgaacacattcttttcacacattccaaactctgtggctctaaaaacaattcatcaacactatttgtgtgctcataccatagtgccattctgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402814 |
tccaattgaacacattcttttcacacattccaaactctgtggctctaagaataattcatcaacactatttgtgtgctcataccatagtgccattctgtat |
5402715 |
T |
 |
| Q |
101 |
gcatgaacatcaccaaggtttctttgtttctcaagttcatcttgagattgaaagcatcctatggctatctcagcgtccctttttccatccatggatcttt |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| | |||| ||||||||||||||||||||| |
|
|
| T |
5402714 |
gcatgaacatcaccaaggtttgtttgtttctcaagttcatcttgagattgaaagcatcctatggcaatctctgtgtccttttttccatccatggatcttt |
5402615 |
T |
 |
| Q |
201 |
ggtttatattagctgaacctattaatatgtacatgtcatccact |
244 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402614 |
ggttcatattagctgaacctattaatatgtacatgtcatccact |
5402571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University