View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11281_low_4 (Length: 213)
Name: NF11281_low_4
Description: NF11281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11281_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 7 - 211
Target Start/End: Original strand, 3647259 - 3647466
Alignment:
| Q |
7 |
ctaatatcatggaagctgaagtccaaccaccagttttagatctttctgctggaaaacccttacagtcgtaggcatcagggacaattttctcttgt---gt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
3647259 |
ctaatatcatggaagctgaagtccaaccaccagttttagatctttctgctggaaaacccttacagtcataggcatcagggacaattttctcttgttgtgt |
3647358 |
T |
 |
| Q |
104 |
tgttgtggggagagtgtccattgtttcaactttcaatgaagagcaaagttatgttgtttctgtcttcatttatactccaaggtgtaaaggctaggcccac |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3647359 |
tgttgtggggagactgtccattgtttcaactttcaatgaagagcaaagttatgttgtttctgtcttcatttatactccaaggggtaaaggctaggcccac |
3647458 |
T |
 |
| Q |
204 |
atatatat |
211 |
Q |
| |
|
|||||||| |
|
|
| T |
3647459 |
atatatat |
3647466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University