View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11282_high_10 (Length: 363)
Name: NF11282_high_10
Description: NF11282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11282_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 18161225 - 18161058
Alignment:
| Q |
18 |
cctgtgtgaatgtgttcaccaagatgattctgtcagcggtggaatcttccgtggcatgggaatcggaactatgatctgggttggtgttgtttgaagatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18161225 |
cctgtgtgaatgtgttcaccaagatgattctgtcagtggtggaatcttccgtggcatgggaatcggaactatgatctgggtctgtgttgtttgaagatga |
18161126 |
T |
 |
| Q |
118 |
atgtgaaaggcttaacattctgatcgttctttcgaacagagaagaaatttcagcttctaaagccatcg |
185 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18161125 |
atgtgaaaggcttaacattctgatcattctttcgaacagagaagaaatttctgcttctaaagccatcg |
18161058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 315 - 347
Target Start/End: Complemental strand, 18160943 - 18160911
Alignment:
| Q |
315 |
gttgtcgaaggatctggaacatggtatttggtg |
347 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
18160943 |
gttgtcgaaggatctggaacatggtattaggtg |
18160911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University