View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11282_high_18 (Length: 255)
Name: NF11282_high_18
Description: NF11282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11282_high_18 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 255
Target Start/End: Complemental strand, 30171439 - 30171202
Alignment:
| Q |
15 |
gagcaacagtttgaacgaatcagcacatgaaaaggcttattccactggacaccatgtaatgtaactcatgaccatattattaattatgtgatcacatttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30171439 |
gagcaacagtttgaacgaatcagcacatgaaaaggcttattccactggacaccatgtaatgtaactcatgaccatattattaattatgtgatcacatttt |
30171340 |
T |
 |
| Q |
115 |
cttctaggtgatactatagtacaatgaaattaataattaattgcttagttgtattgaattaatcaggttgctaaccaaacaaaagacgcagttaataagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30171339 |
cttctaggtgatactatagtacaatgaaat---taattaattgcttagttgtattgaattaatcaggttgctaaccaaacaaaagacgcagctaataagg |
30171243 |
T |
 |
| Q |
215 |
catcagcggcaacacaaaacatagcagagaaagcaaagcag |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30171242 |
catcagcggcaacacaaaacatagcagagaaagcaaagcag |
30171202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University