View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11282_high_22 (Length: 235)

Name: NF11282_high_22
Description: NF11282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11282_high_22
NF11282_high_22
[»] chr7 (1 HSPs)
chr7 (18-217)||(30761976-30762175)


Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 30761976 - 30762175
Alignment:
18 agaaggttagaagatcatgtgagacagtacaagatcatttgatggctgagaggaaaaggagaagggaattaactgagaatatcatagcactttcagccat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30761976 agaaggttagaagatcatgtgagacagtacaagatcatttgatggctgagaggaaaaggagaagggaattaactgagaatatcatagcactttcagccat 30762075  T
118 gatacctggcttgaaaaaggttagtttctttctatgatttcattattgatctaaagttaatttaaaagtatacaatcatatgattgttaaatgaaccatt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30762076 gatacctggcttgaaaaaggttagtttctttctatgatttcattattgatctaaagttaatttaaaagtatacaatcatatgattgttaaatgaaccatt 30762175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University