View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11282_high_23 (Length: 206)
Name: NF11282_high_23
Description: NF11282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11282_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 46468049 - 46467863
Alignment:
| Q |
17 |
aatagcttctttgcgctttggtgttcttttgagagtgttcctccgcctgctgccttcatggtaacgacgtcgacggtggtggtggatttcgagtgtttct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46468049 |
aatagcttctttgcgctttggtgttcttttgagagtgttcctccgcctgctgctttcatggtaacgacgtcgacggtggtggtggatttcgagtgtttct |
46467950 |
T |
|
| Q |
117 |
ccgacgaagataaaggtttggtaacgacgcgctttggtgtcacgactactctatcttccgtcaaaccctttcccttcatctctctcg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
46467949 |
ccgacgaagataaaggtttggtaacgacgcgttttggtgtcacgactactctatcttctgtcaaaccctttccctccatctctctcg |
46467863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 20 - 136
Target Start/End: Original strand, 17236359 - 17236478
Alignment:
| Q |
20 |
agcttctttgcgctttggtgttcttttgagagtgttcctccgcctgctgc--ctt-catggtaacgacgtcgacggtggtggtggatttcgagtgtttct |
116 |
Q |
| |
|
|||||||| |||||||||||| ||| |||||| |||||||||||| || | ||| |||||||||||| ||||||||||||||| || |||||||| | |
|
|
| T |
17236359 |
agcttcttcgcgctttggtgtacttctgagagcgttcctccgcctcctcctacttccatggtaacgactgcgacggtggtggtgggttctgagtgttttt |
17236458 |
T |
|
| Q |
117 |
ccgacgaagataaaggtttg |
136 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
17236459 |
ccggtgaagataaaggtttg |
17236478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University