View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11282_high_8 (Length: 381)
Name: NF11282_high_8
Description: NF11282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11282_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 327; Significance: 0; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 371
Target Start/End: Complemental strand, 34657088 - 34656717
Alignment:
| Q |
1 |
taccgaaatatactaatggggtaaatgttcagaaattgtatttcagactagaaaaggaactacagattctgacaattgnnnnnnn-ttggcttgttttct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34657088 |
taccgaaatatactaatggggtaaatgttcaaaaattgtatttcagactagaaaaggaactacagattctgacaattgaaaaaaaattggcttgttttct |
34656989 |
T |
 |
| Q |
100 |
ggcaaggaaatacaacataattggtcaaagttggcacctacaccataatggtatcaagaacaaaaatatgatcatcccaaaaatctaaggttcagaaagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34656988 |
ggcaaggaaatacaacataattggtcaaagttggcacctacaccataatggtatcaagaacaaaaatatgatcatcccaaaaatctaaggttcagaaagt |
34656889 |
T |
 |
| Q |
200 |
accgacaatcaatttttgaagttttactgcctcaagtacttttggtcagcatttaattatactctatagtggtcagcaaaatttaatatatttaaaacct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34656888 |
accgacaatcaatttttgaagttttactgcctcaagtacttttggtcagcatttaattatactctatagtggtcagcaaagtttaatatatttaaaacct |
34656789 |
T |
 |
| Q |
300 |
tgaaccttaaccaacaatgcattggttcaagtggtaagggacttggaccccttaagcaagtggtcacaggtt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
34656788 |
tgaaccttaaccaacaatgcattggttcaagtggtacgggacttggaccccttaagccagtggtcacaggtt |
34656717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 308 - 365
Target Start/End: Complemental strand, 43460323 - 43460266
Alignment:
| Q |
308 |
aaccaacaatgcattggttcaagtggtaagggacttggaccccttaagcaagtggtca |
365 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
43460323 |
aaccaacaatggattggtccaagtggtaagggacttgaaccccttaagcatgtggtca |
43460266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 309 - 357
Target Start/End: Complemental strand, 55245728 - 55245680
Alignment:
| Q |
309 |
accaacaatgcattggttcaagtggtaagggacttggaccccttaagca |
357 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
55245728 |
accaacaatggattggtccaaatggtaagggacttgggccccttaagca |
55245680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 307 - 372
Target Start/End: Complemental strand, 38614680 - 38614615
Alignment:
| Q |
307 |
taaccaacaatgcattggttcaagtggtaagggacttggaccccttaagcaagtggtcacaggttc |
372 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||| | ||||| |||||| |
|
|
| T |
38614680 |
taaccaacaatcgattggttcaagtggtaagtgacttggaccccttaagcatgcggtcaaaggttc |
38614615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 307 - 360
Target Start/End: Original strand, 3885460 - 3885513
Alignment:
| Q |
307 |
taaccaacaatgcattggttcaagtggtaagggacttggaccccttaagcaagt |
360 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
3885460 |
taaccaacaatggattggttcaagtggtaagaaacttggactccttaagcaagt |
3885513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 309 - 365
Target Start/End: Original strand, 5485290 - 5485346
Alignment:
| Q |
309 |
accaacaatgcattggttcaagtggtaagggacttggaccccttaagcaagtggtca |
365 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
5485290 |
accaacactggattggttcaagtggtaagggacttgggtgcgttaagcaagtggtca |
5485346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 309 - 354
Target Start/End: Complemental strand, 44288608 - 44288563
Alignment:
| Q |
309 |
accaacaatgcattggttcaagtggtaagggacttggaccccttaa |
354 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
44288608 |
accaacaattgattggttcaagtggtaagagacttggaccccttaa |
44288563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 309 - 361
Target Start/End: Original strand, 17833437 - 17833489
Alignment:
| Q |
309 |
accaacaatgcattggttcaagtggtaagggacttggaccccttaagcaagtg |
361 |
Q |
| |
|
|||||||||| ||| | |||||||||||||| |||||||||||||||||||| |
|
|
| T |
17833437 |
accaacaatggatttatccaagtggtaagggatttggaccccttaagcaagtg |
17833489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 365
Target Start/End: Complemental strand, 4430925 - 4430888
Alignment:
| Q |
328 |
aagtggtaagggacttggaccccttaagcaagtggtca |
365 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4430925 |
aagtggtaagggactcggacaccttaagcaagtggtca |
4430888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University