View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11282_low_16 (Length: 320)
Name: NF11282_low_16
Description: NF11282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11282_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 48570605 - 48570471
Alignment:
| Q |
1 |
ttgctctctagggcttttctttgaaccaaaacttgatttttatcagagcctcttacttgtggtgattctaccttgatcttatcattccgttatggattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570605 |
ttgctctctagggcttttctttgaaccaaaacttgatttttatcagagcctcttacttgtggtgattctaccttgatcttatcattccgttatggattat |
48570506 |
T |
|
| Q |
101 |
ggccatttctaccatttccttccgagtacttcacc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570505 |
ggccatttctaccatttccttccgagtacttcacc |
48570471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 170 - 305
Target Start/End: Complemental strand, 48570436 - 48570301
Alignment:
| Q |
170 |
gctactttgttggaataaatcgatatcattaagttagattcttcgactcatatggaagcacttaaatcgatatcatgtgatattcacagcctatcaccac |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48570436 |
gctactttgttggaataaatcgatatcattaagttagattcttcgactcatatggaagcacttaaatcgatatcatgtgatattcacagcctctcaccac |
48570337 |
T |
|
| Q |
270 |
aagtgataatgtttgctattaattttgtttttatat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570336 |
aagtgataatgtttgctattaattttgtttttatat |
48570301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University