View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11282_low_20 (Length: 250)
Name: NF11282_low_20
Description: NF11282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11282_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 36568528 - 36568766
Alignment:
| Q |
1 |
ctgtttgctccaaaactttcaatagatataacaacatgcaggtagatatatcattatcaannnnnnnnnnnntaaagaccttgttcttttgttttgtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36568528 |
ctgtttgctccaaaactttcaatagatataacaacatgcaggtagatatatcattatcaaacacacacacactaaagaccttgttcttttgttttgtttc |
36568627 |
T |
|
| Q |
101 |
atctttcacacttcccttataaatcaagatttaaaataaaaggagaaaaataataatttttctttgctactgcttctgcttctgcttcccttttctgtca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36568628 |
atctttcacacttcccttataaatcaagatttaaaataaaaggagaaaaataataatttttctttgcta------ctgcttctgcttcccttttctgtca |
36568721 |
T |
|
| Q |
201 |
ataactttcttccttgatttgaaccattaacggttctctgctgct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
36568722 |
ataactttcttccttgatttgaaccattaacgattctctgatgct |
36568766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University