View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11282_low_5 (Length: 443)
Name: NF11282_low_5
Description: NF11282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11282_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 3e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 239 - 434
Target Start/End: Complemental strand, 35859631 - 35859437
Alignment:
| Q |
239 |
gagccagctttgatttgatatggtgggtcatgaacattaagttaatgatatcacatgtgcaaggtatacacttttcctgtgatgtatgtggagggtttcg |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35859631 |
gagccagctttgatttgatatggtgggtcatgaacatttaattaatgatatcacatgtgcaaggtatacacttttcgtgtgatgtatgtggagggtttcg |
35859532 |
T |
|
| Q |
339 |
tgggcggggaacaaaactttaaaattgaaattatgtctttgtgtgtgtggaccgtgtgactatggtagatgatatcatgacaatttgtgttcatct |
434 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35859531 |
tgggcggggaacaaaactttaaaatcgaaattatgtc-ttgtgtgtgtggaccgtgtgactatggtagatgatatcatgacaatttgtgttcatct |
35859437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 16 - 181
Target Start/End: Complemental strand, 35859854 - 35859689
Alignment:
| Q |
16 |
gtttcttcatgctgccgcgatacaccagatagtttgcttagttttgaagttagttttacagctcataaacaactggaaaagnnnnnnnnnntcatatatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35859854 |
gtttcttcatgctgccgcgatacaccagatagtttgcttagttttgaagttagttttacagctcataaacaactggaaaagaaaaaaaaaatcatatatc |
35859755 |
T |
|
| Q |
116 |
ttatatgatgatttaacttagggtttgatttaatatatgttattagatagttttagttgaattgcc |
181 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35859754 |
ttatatgatgatttaacttagggtttaatttaatatatgttattagatagttttagttgaattgcc |
35859689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University