View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11284_high_18 (Length: 304)
Name: NF11284_high_18
Description: NF11284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11284_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 59 - 293
Target Start/End: Complemental strand, 40853737 - 40853500
Alignment:
| Q |
59 |
ctttcgttgttcaaaacatctttcactatgcccttctcttctaccatacctttctcaattctcagcaacaaaaacagaatatgaatattaataattaact |
158 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40853737 |
ctttcattgttcaaaacatctttcactatacccttctcttctaccatacctttctcaattctcagcaacaaaaacagaatatgaatattaataattaact |
40853638 |
T |
 |
| Q |
159 |
atgatgacgcatcaccggcaataattttagaaaacagcatgattgaatgtaatcaaattcgccagtgtgtgacaggtgtc-gtgtcgaacaccgacatgt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
40853637 |
atgatgacgcatcaccggcaataattttagaaaacagcatgattgaatgtaatcaaattcgccagtgcgtgacaggtgtcagtgtcgaacaccgacatgt |
40853538 |
T |
 |
| Q |
258 |
gacggtg--acacacgccttccaatcagtctgtgctcc |
293 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
40853537 |
gacggtgacacacacgccttccaatcagtcagtgctcc |
40853500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University