View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11284_high_21 (Length: 284)
Name: NF11284_high_21
Description: NF11284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11284_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 21 - 272
Target Start/End: Original strand, 38207126 - 38207381
Alignment:
| Q |
21 |
ttctatcactcgcaacatctcttttgtaa-ttttctaatcacatatgccatctttgtcccaagtattatttgcacttctggtggttgtctgaaacttctc |
119 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
38207126 |
ttctatcactcgcaacatttcttttgttccttttctaatcacatatgctatctt-gtcccaagtattatttgcacttctcgtggttgtccgaaacttctc |
38207224 |
T |
 |
| Q |
120 |
tctagaatattgtgttgaatacttctctattttaatccttcaaacgtcgccacttgattcgtagagcctgctgtaacttattgtcatatatatacgacta |
219 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38207225 |
tctagaatattgtgttgaatacttatctattttcatccttcaaacgtcgccacttgattcgtagagcctgctgtaacttattgtcatatatatacgacta |
38207324 |
T |
 |
| Q |
220 |
tatcattgcacaacttata----tgacatggataactatttcaacgttactgcttct |
272 |
Q |
| |
|
||||||||||||||||||| | |||| ||||||||||||||||||||||||||| |
|
|
| T |
38207325 |
tatcattgcacaacttatataactaacatagataactatttcaacgttactgcttct |
38207381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University