View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11284_high_28 (Length: 211)
Name: NF11284_high_28
Description: NF11284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11284_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 51 - 195
Target Start/End: Original strand, 5388576 - 5388720
Alignment:
| Q |
51 |
gtagggacgtacttcttgatatttgcagggtgtgctgctgttgtggtgaatcttgacaatgacaaagtagtaacacatcctgggatctcaattgtttggg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5388576 |
gtagggacgtacttcttgatatttgcagggtgtgctgctgttgtggtgaatcttgacaatgacaaagtagtaacacatcctgggatctcaattgtttggg |
5388675 |
T |
 |
| Q |
151 |
gcctcactgttatggttttggtttactctgttggtcacatctctg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5388676 |
gcctcactgttatggttttggtttactctgttggtcacatctctg |
5388720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 51 - 195
Target Start/End: Original strand, 5402385 - 5402529
Alignment:
| Q |
51 |
gtagggacgtacttcttgatatttgcagggtgtgctgctgttgtggtgaatcttgacaatgacaaagtagtaacacatcctgggatctcaattgtttggg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402385 |
gtagggacgtacttcttgatatttgcagggtgtgctgctgttgtggtgaatcttgacaatgacaaagtagtaacacatcctgggatctcaattgtttggg |
5402484 |
T |
 |
| Q |
151 |
gcctcactgttatggttttggtttactctgttggtcacatctctg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402485 |
gcctcactgttatggttttggtttactctgttggtcacatctctg |
5402529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 67 - 195
Target Start/End: Original strand, 5415136 - 5415264
Alignment:
| Q |
67 |
tgatatttgcagggtgtgctgctgttgtggtgaatcttgacaatgacaaagtagtaacacatcctgggatctcaattgtttggggcctcactgttatggt |
166 |
Q |
| |
|
|||||||||| || |||||||||||| | ||||||||| ||||||| | |||||||||| |||||| || || ||| |||||| ||||||||||||| |
|
|
| T |
5415136 |
tgatatttgcgggttgtgctgctgttattgtgaatcttaacaatgatcatgtagtaacacttcctggaattgcatttgcttggggattcactgttatggt |
5415235 |
T |
 |
| Q |
167 |
tttggtttactctgttggtcacatctctg |
195 |
Q |
| |
|
|||| ||||||||||||||||||| |||| |
|
|
| T |
5415236 |
tttgatttactctgttggtcacatttctg |
5415264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 62 - 195
Target Start/End: Original strand, 5396696 - 5396829
Alignment:
| Q |
62 |
cttcttgatatttgcagggtgtgctgctgttgtggtgaatcttgacaatgacaaagtagtaacacatcctgggatctcaattgtttggggcctcactgtt |
161 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||| ||| ||||||| ||||| || |||| |||||| || |||||||||||||| || ||||| |
|
|
| T |
5396696 |
cttcttgatatttgctggatgtgctgctgtggtggtgaaccttaacaatgataaagttgtgacacttcctggaatatcaattgtttggggacttgctgtt |
5396795 |
T |
 |
| Q |
162 |
atggttttggtttactctgttggtcacatctctg |
195 |
Q |
| |
|
||||| || || || ||| | ||||| ||||||| |
|
|
| T |
5396796 |
atggtattagtctattctataggtcatatctctg |
5396829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 62 - 151
Target Start/End: Complemental strand, 5408082 - 5407993
Alignment:
| Q |
62 |
cttcttgatatttgcagggtgtgctgctgttgtggtgaatcttgacaatgacaaagtagtaacacatcctgggatctcaattgtttgggg |
151 |
Q |
| |
|
||||||||||||||| || |||| | |||| |||||||| ||| ||||||| ||||| || |||| |||||| || ||||||||||||| |
|
|
| T |
5408082 |
cttcttgatatttgctggatgtggttctgtggtggtgaaccttaacaatgataaagttgtgacacttcctggaattgcaattgtttgggg |
5407993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 106 - 195
Target Start/End: Original strand, 36267626 - 36267715
Alignment:
| Q |
106 |
acaatgacaaagtagtaacacatcctgggatctcaattgtttggggcctcactgttatggttttggtttactctgttggtcacatctctg |
195 |
Q |
| |
|
||||||| || || ||||||| |||||| || |||||||||||||| || |||| ||||| ||||||||||| ||||||||||||||| |
|
|
| T |
36267626 |
acaatgaaaatgttgtaacacttcctggaatttcaattgtttggggacttgctgtgatggtgctggtttactctcttggtcacatctctg |
36267715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 195
Target Start/End: Original strand, 36262464 - 36262554
Alignment:
| Q |
105 |
gacaatgacaaagtagtaacacatcctgggatctcaattgtttggggcctcactgttatggttttggtttactctgttggtcacatctctg |
195 |
Q |
| |
|
||||| ||||| |||||||||| ||| ||||| ||||||||||||| || ||| | |||| ||| |||||||| ||||||| ||||||| |
|
|
| T |
36262464 |
gacaacgacaacgtagtaacacttccagggattgcaattgtttggggactaactttgttggtattgatttactctcttggtcatatctctg |
36262554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University