View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11284_low_21 (Length: 289)
Name: NF11284_low_21
Description: NF11284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11284_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 16 - 161
Target Start/End: Complemental strand, 45889968 - 45889823
Alignment:
| Q |
16 |
gactcaaacttcattcttatcgtttgtctatatttaattatacaatatttctaacggnnnnnnnnnnnngaaagttgcatgtattgcctcaaaccaacta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45889968 |
gactcaaacttcattcttatcgtttgtctgtatttaattttacaatatttctaacggaaaaataaaaaagaaagttgcatgtattgcctcaaaccaacta |
45889869 |
T |
|
| Q |
116 |
ctaataacgtatacgaatataccataggacaccagcctcctttaaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45889868 |
ctaataacgtatacgaatataccataggacaccagcctcctttaaa |
45889823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 184 - 267
Target Start/End: Complemental strand, 45889798 - 45889715
Alignment:
| Q |
184 |
cttgtgaatttaagtataatccaaaatttatgagattatgagcagttttattccacaagtttgcgacaatggcttctcttattt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45889798 |
cttgtgaatttaagtataatccaaaatttatgagattatgagcagttttattccacaagtttgcgacaatggcttctcttattt |
45889715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University