View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11284_low_26 (Length: 222)
Name: NF11284_low_26
Description: NF11284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11284_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 10044135 - 10044338
Alignment:
| Q |
1 |
gaagggttgtgaggattttatcaagaaggacaaagaacaatcctgttattataggtgagccaggtgttggtaaaacagctgttgttgaagggttggctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10044135 |
gaagggttgtgaggattttatcaagaaggacaaagaacaatcctgttattataggtgagccaggtgttggtaaaacagctgttgttgaagggctggctaa |
10044234 |
T |
|
| Q |
101 |
gagaatagttagaggagatgttcctagtaatcttgccgatgttagattatttgctttggatatgggagcgttagtcgctggtactcagtataggggacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10044235 |
gagaatagttagaggagatgttcctagcaatcttgctgatgttaggttatttgctttggatatgggagcgttagtcgctggtactcagtataggggacaa |
10044334 |
T |
|
| Q |
201 |
tttg |
204 |
Q |
| |
|
|||| |
|
|
| T |
10044335 |
tttg |
10044338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 45466247 - 45466450
Alignment:
| Q |
1 |
gaagggttgtgaggattttatcaagaaggacaaagaacaatcctgttattataggtgagccaggtgttggtaaaacagctgttgttgaagggttggctaa |
100 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||| ||||| ||||| ||| |||| |||||||| |||||||| ||||| ||||||||||||||||||||| | |
|
|
| T |
45466247 |
gaagagttgtgaggattttgtcaaggaggactaagaataatccagttcttattggtgagcctggtgttgggaaaactgctgttgttgaagggttggctca |
45466346 |
T |
|
| Q |
101 |
gagaatagttagaggagatgttcctagtaatcttgccgatgttagattatttgctttggatatgggagcgttagtcgctggtactcagtataggggacaa |
200 |
Q |
| |
|
||| || |||||||| ||||||||||| |||||||| |||||||| ||| ||||| ||||||||||||| || || |||||| | ||||||||||| || |
|
|
| T |
45466347 |
gaggattgttagaggtgatgttcctagcaatcttgctgatgttaggttaattgctctggatatgggagcattggttgctggtgcgaagtataggggagaa |
45466446 |
T |
|
| Q |
201 |
tttg |
204 |
Q |
| |
|
|||| |
|
|
| T |
45466447 |
tttg |
45466450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University