View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11284_low_7 (Length: 521)
Name: NF11284_low_7
Description: NF11284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11284_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 8e-87; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 8e-87
Query Start/End: Original strand, 295 - 473
Target Start/End: Complemental strand, 3919072 - 3918894
Alignment:
| Q |
295 |
gtaatataaacgctagatgtaaacatgaactaatttatctatctctcagttgtacccagtaactacctattaaccaattcttactcaactgtgaacaaaa |
394 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
3919072 |
gtaatgtaaacgctagatgtaaacatgaactaatttatctatctctcagttgtacccagtaactatctattaaccaattcttacttaactgtgaacaaaa |
3918973 |
T |
 |
| Q |
395 |
caagaataaccatctaaagatgattcagaaatgtaagaggaatcaaattcagaatttaacaattgtcaagtttgcgaag |
473 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3918972 |
caagaataaccatctaaagatgattcagaaatgtaagagaaatcaaattcagaatttaacaattgtcaagtttgcgaag |
3918894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 145 - 270
Target Start/End: Complemental strand, 3919236 - 3919110
Alignment:
| Q |
145 |
cacatgtcttgcatccaaggcactggatg-actaaatgaagcgtacctgaactcatgtcaaatatcctttccaaccaactacattgtggccaacctgcac |
243 |
Q |
| |
|
||||||||||||||||||| ||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3919236 |
cacatgtcttgcatccaagatactcgatggactaaatcgagcgtacctgaactcatgtcaaatatcctttccaaccaactacattgtggccaacctgcag |
3919137 |
T |
 |
| Q |
244 |
aaccgatccaattatcagaacaactta |
270 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
3919136 |
aaatgatccaattatcagaacaactta |
3919110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 17 - 74
Target Start/End: Complemental strand, 3919361 - 3919304
Alignment:
| Q |
17 |
accgaaatgtaaagattcgattggcaatcaaaattgagaaaaacaatgatgataatga |
74 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3919361 |
accgaaatataaagatttgattggtaatcaaaattgagaaaaacaatgatgataatga |
3919304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University