View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11285_high_1 (Length: 532)
Name: NF11285_high_1
Description: NF11285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11285_high_1 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 250 - 532
Target Start/End: Original strand, 5997859 - 5998141
Alignment:
| Q |
250 |
aaatttggtattctctgtcttttcttgtcgatggttgcccttagtgttacggtgttccagaactgaagaggcacattggactcactgaagaaaattcttt |
349 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5997859 |
aaatttggtattctctgtcttttctcgtcgatggttgcccttagtgttacggtgttccagaactgaaggggcacattggactcactgaagaaaattcttt |
5997958 |
T |
 |
| Q |
350 |
ccttgtttatggccccccttagtgttatgttgttccagatactagtaagttctcatcaatctcactagctttctttatcactcattcgtccaacatttgt |
449 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5997959 |
ccttgtttatggccccccttagtgttatgttgttccagatactagtaagttctcatcaatttcactagctttctttatcactcattcgtccaacatttgt |
5998058 |
T |
 |
| Q |
450 |
tgtttatcaatatatgcacttcaaaatctcactttactttgtttgatttgagtgtgctagtttgtgaatttgtaacaatgcct |
532 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998059 |
tgtttatcaatatatgcacttcaaaatctcactttactttgtttgatttgagtgtgctagtttgtgaatttgtaacaatgcct |
5998141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University