View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11285_high_9 (Length: 237)
Name: NF11285_high_9
Description: NF11285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11285_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 2356227 - 2356007
Alignment:
| Q |
1 |
caaaataccgcttcccaacaatcatcggaagtacaatgttgaaattcaactcaataaaccattgcctcaactcgactaacacatagttggactcgttatt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2356227 |
caaaatatcgcttcccaacaatcatcggaagtacaatgttgaaattcaactcaataaaccattgcctcaactcgactaacacatagttggactcgttatt |
2356128 |
T |
|
| Q |
101 |
actcttccaaacattgaagagctctttaatcgaagtttgaacttccaaaacacaaatttcttgtagtttttcaatacgacgattagcaaggatctctgac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2356127 |
actcttccaaacattgaagagctctttaatcgaagtttgaacttccaaaacacaaatttcttgtagtttttcaatacgacgattaacaaggatctctgac |
2356028 |
T |
|
| Q |
201 |
aatgctatctcacgcacttgg |
221 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
2356027 |
aatgctatcttacgcacttgg |
2356007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 145
Target Start/End: Original strand, 5805873 - 5805911
Alignment:
| Q |
107 |
ccaaacattgaagagctctttaatcgaagtttgaacttc |
145 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
5805873 |
ccaaatattgaagagctctttaatcgatgtttgaacttc |
5805911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 143
Target Start/End: Complemental strand, 4303566 - 4303530
Alignment:
| Q |
107 |
ccaaacattgaagagctctttaatcgaagtttgaact |
143 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
4303566 |
ccaaacattgtagagctctttaatcgaagttcgaact |
4303530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University