View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11285_low_8 (Length: 249)
Name: NF11285_low_8
Description: NF11285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11285_low_8 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 5998520 - 5998282
Alignment:
| Q |
12 |
aagaagcaacaggcaaaattcatttagattcattcatcatttttcattatctttcggaataattctcaactcgtaccatcccacacaaaagcttgtacaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998520 |
aagaagcaacaggcaaaattcatttagattcattcatcatttttcattatctttcggaataattctcaactcgtaccatcccacacaaaagcttgtacaa |
5998421 |
T |
 |
| Q |
112 |
ctttattccaatcatgacaaaatactaaaataacatctatagagtcaggtta-aaaagaggaaccaaatcaacagaaactaaactgaactacaatacact |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998420 |
ctttattccaatcatgacaaaataataaaataacatctatagagtcaggttataaaagaggaaccaaatcaacagaaactaaactgaactacaatacact |
5998321 |
T |
 |
| Q |
211 |
tttatgttggtgaccacaaggctttataaaacgtagttt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998320 |
tttatgttggtgaccacaaggctttataaaacgtagttt |
5998282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University