View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11287_high_14 (Length: 307)
Name: NF11287_high_14
Description: NF11287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11287_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 302
Target Start/End: Complemental strand, 8418076 - 8417792
Alignment:
| Q |
18 |
gagggaatctatactcttatcattatggatggcttgtggagggcgagaactgataagatgtaacatattcgtattcggtctcaagctcaccttagctcac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8418076 |
gagggaatctatactcttatcattatggatggcttgtggagggcgagaactgataagatgtaaaatattcgtattcggtctcaagcttaccttagctcac |
8417977 |
T |
 |
| Q |
118 |
tctctcaaggattgtaatgtcaacctactaatgtttttgtgcgaataaaatagcttggttggtcaaaagagtagtatgtggctggttcctgaagatggat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8417976 |
tctctcaaggattgtaatgtcaacctaccaaagtttttgtccgaataaaatagcttggttggtcaaaagagtagtatgtggctggttcctgaagatggat |
8417877 |
T |
 |
| Q |
218 |
gagttaaatttaatggagatggttttgatacaaattttggaggttgtgcttgtgcaacgtgtggtggggttgtgcctttgcttct |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8417876 |
gagttaaatttaatggagatggttttgatacaaattttggaggttgtgcttgtgcaacgtgtggtggggttgtgcttttgcttct |
8417792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University