View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11287_high_28 (Length: 216)
Name: NF11287_high_28
Description: NF11287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11287_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 49086399 - 49086589
Alignment:
| Q |
18 |
gtgggatctgtcgaagcatgagaaccaaacatgtgtagaactatactaaacacacataatcaatagtgagcaaaccaattttcattgaatgcagaaactg |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49086399 |
gtgggatctggcgaagcatgagaaccaaacatgtgtagaactatactaaacacacataatcaatagtgagcaaaccaattttcattgcatgcagaaactg |
49086498 |
T |
|
| Q |
118 |
ttggttttataagtctataagtttatccaaatgtcggtgaaacgactcgatctaagccacgtctccttcattccattgtcccttcttctca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49086499 |
ttggttttataagtctataagtttatccaaatgtcggtgaaacgacccgatctaagccacgtctccttcattccattgtcccttcttctca |
49086589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University