View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11287_low_10 (Length: 359)
Name: NF11287_low_10
Description: NF11287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11287_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 17 - 339
Target Start/End: Original strand, 38930863 - 38931185
Alignment:
| Q |
17 |
aatcaggagttgccaaaacaccctcattacgattattcttcaactcattcacttcttgtggactaagcccaaaaacatgagcaagtacttccccaggtgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38930863 |
aatcaggagttgccaaaacaccctcattacgattattcttcaactcattcacttcttgtggactaagcccaaaaacatgagcaagtacttccccaggtgt |
38930962 |
T |
 |
| Q |
117 |
tgcactaatcgctgaatcacgccctatcattgtactaatctcagctctatcatttgttttgaaaactatgtattccaatccctcactctccgcctgttct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38930963 |
tgcactaatcgctgaatcacgccctatcattgtactaatctcagctctatcatttgttttgaaaactatgtattccaatccctcactctccgcctgttct |
38931062 |
T |
 |
| Q |
217 |
gccaccgcgaaattctgcggcaccaccaacaatcttcccctttttacctctccattgaacaccgattttccctcactattcaccacttgaaccctccctc |
316 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931063 |
gccactgcgaaattctgcggcaccaccaacaatcttcccctttttacctctccattgaacactgattttccctcactattcaccacttgaaccctccctc |
38931162 |
T |
 |
| Q |
317 |
ttcctcttgttacatacattatg |
339 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
38931163 |
ttcctcttgttacgtacattatg |
38931185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University