View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11287_low_20 (Length: 261)
Name: NF11287_low_20
Description: NF11287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11287_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 49086399 - 49086631
Alignment:
| Q |
18 |
gtgggatctgtcgaagcatgagaaccaaacatgtgtagaactatactaaacacacataatcaatagtgagcaaaccaattttcattgaatgcagaaactg |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49086399 |
gtgggatctggcgaagcatgagaaccaaacatgtgtagaactatactaaacacacataatcaatagtgagcaaaccaattttcattgcatgcagaaactg |
49086498 |
T |
|
| Q |
118 |
ttggttttataagtctataagtttatccaaatgtcggtgaaacgactcgatctaagccacgtctccttcattccattgtcccttcttctcatttattttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49086499 |
ttggttttataagtctataagtttatccaaatgtcggtgaaacgacccgatctaagccacgtctccttcattccattgtcccttcttctcatttattttt |
49086598 |
T |
|
| Q |
218 |
gaggtaagcaaaatcaaaagcaccactacctat |
250 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
49086599 |
gaggaaagcaaaatcaaaagcaccactacctat |
49086631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University