View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11287_low_23 (Length: 248)
Name: NF11287_low_23
Description: NF11287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11287_low_23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 20 - 248
Target Start/End: Original strand, 8045786 - 8046011
Alignment:
| Q |
20 |
catgcaaacactcaaacgttttataagtcaatctttaattcagaagagtaagagactttttgaatagaatatgaacttgtcgagtaagagttttaagata |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | ||||||||| ||||| ||||| ||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
8045786 |
catgcaaacactcaaacgttt---aagtcaatctttgactcagaagagcaagaggcttttcaaatagaatatgaacttgtcgaataagagttttaggata |
8045882 |
T |
|
| Q |
120 |
tatcggcaaattcgctagaaactttgagatatcgttttaatttttgacataattaagatttaattttcggtatctggtccagatttttatagtattcaac |
219 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8045883 |
tattggcaaattcgctagaaactttgagatattgttttattttttgacataattaagatttaattttcggtatctgatccagatttttatagtattcaac |
8045982 |
T |
|
| Q |
220 |
aacatttctataatattctgcatgctcct |
248 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
8045983 |
aacatatctataatattctgcatgctcct |
8046011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University