View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1128_high_11 (Length: 362)
Name: NF1128_high_11
Description: NF1128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1128_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 103 - 351
Target Start/End: Complemental strand, 13673979 - 13673731
Alignment:
| Q |
103 |
aaattattattagtgtaagtattgtgtccaatgtatgtgtcagcgcttcatagaaaaggatgcttattttcttacttgtttcatgaatggccgcttggag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13673979 |
aaattattattagtgtaagtattgtgtccaatgtatgtgtcagcgcttcatagaaaaggatgcttattttcttacttgtttcatgaatggccgcttggag |
13673880 |
T |
 |
| Q |
203 |
gatgaatggtggacgcacaaggaagctgtcttcatggcacggttcatttcggtgggatcatatttctcttctaatctaggatctgctagctcttggacat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13673879 |
gatgaatggtggacgcacaaggaagctgtcttcatggcacggttcatttcggtgggatcatatttctcttctaatctaggatctgctagctcttggacat |
13673780 |
T |
 |
| Q |
303 |
tttttgagtcaagaagtggcttggcctgacaatagtagatcatgttcat |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13673779 |
tttttgagtcaagaagtggcttggcctgacaatagtagatcatgttcat |
13673731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University