View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1128_low_27 (Length: 315)
Name: NF1128_low_27
Description: NF1128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1128_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 33 - 218
Target Start/End: Original strand, 21662395 - 21662581
Alignment:
| Q |
33 |
aatgggtgtagagaatggcaatgtttggtagtagtattatctaatagagtgtgttgattgattgataggtttaaaatggatatttgaaccaaaagtgtac |
132 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
21662395 |
aatgggtgtagagaatgacaatgtttgctagtagtattatctaatagagtatgttgattgattgatagctgtaaaatggatatttgaaccaaaagtgtac |
21662494 |
T |
 |
| Q |
133 |
tttataatctcgcacac-aaaatgggttcagtttagtttagttccaatgggatggataacttagataaatgtgtggataaagtaaac |
218 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21662495 |
tttataatctcacacacaaaaatgggttcagttttgtttagttccaatggaatgggtaacttagataaatgtgtggataaagtaaac |
21662581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 76 - 126
Target Start/End: Original strand, 27134937 - 27134987
Alignment:
| Q |
76 |
atagagtgtgttgattgattgataggtttaaaatggatatttgaaccaaaa |
126 |
Q |
| |
|
||||||| ||||||||||||| ||| | | ||||||||||||||||||||| |
|
|
| T |
27134937 |
atagagtatgttgattgattgctagctgttaaatggatatttgaaccaaaa |
27134987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University