View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1128_low_42 (Length: 234)
Name: NF1128_low_42
Description: NF1128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1128_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 59 - 224
Target Start/End: Complemental strand, 675466 - 675301
Alignment:
| Q |
59 |
caaggtctttgagatcacttaattgtttaaattgcattttctcttctattagtccttatgttcctggctggtctgctgttctgttctgagtttgtgggag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
675466 |
caaggtctttgagatcacttaattgtttaaattgcattttctcttctattagtccttatgttcctggctggtctgctgttctgttctgagtttgtgggag |
675367 |
T |
|
| Q |
159 |
ggttgcggtcacgtctagcatttgctggtggctttgaggcttcctttggcgattgcagcttctgtg |
224 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
675366 |
ggttgcggtcccgtctagcatttgctggtggctttgaggcttcctttggcgattgcagcttctgtg |
675301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University