View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1128_low_42 (Length: 234)

Name: NF1128_low_42
Description: NF1128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1128_low_42
NF1128_low_42
[»] chr5 (1 HSPs)
chr5 (59-224)||(675301-675466)


Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 59 - 224
Target Start/End: Complemental strand, 675466 - 675301
Alignment:
59 caaggtctttgagatcacttaattgtttaaattgcattttctcttctattagtccttatgttcctggctggtctgctgttctgttctgagtttgtgggag 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
675466 caaggtctttgagatcacttaattgtttaaattgcattttctcttctattagtccttatgttcctggctggtctgctgttctgttctgagtttgtgggag 675367  T
159 ggttgcggtcacgtctagcatttgctggtggctttgaggcttcctttggcgattgcagcttctgtg 224  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
675366 ggttgcggtcccgtctagcatttgctggtggctttgaggcttcctttggcgattgcagcttctgtg 675301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University